Transcript: Human XM_017024022.1

PREDICTED: Homo sapiens insulin like growth factor 2 mRNA binding protein 1 (IGF2BP1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IGF2BP1 (10642)
Length:
8714
CDS:
286..2013

Additional Resources:

NCBI RefSeq record:
XM_017024022.1
NBCI Gene record:
IGF2BP1 (10642)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024022.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374456 GCGGCCAGTTCTTGGTCAAAT pLKO_005 374 CDS 100% 13.200 18.480 N Igf2bp1 n/a
2 TRCN0000075151 CTCCGCTTGTAAGATGATCTT pLKO.1 1047 CDS 100% 4.950 6.930 N IGF2BP1 n/a
3 TRCN0000218079 ACGCTTAGAGATTGAACATTC pLKO_005 483 CDS 100% 10.800 8.640 N IGF2BP1 n/a
4 TRCN0000230114 GATGGATGCTACGAGTATAAA pLKO_005 6907 3UTR 100% 15.000 10.500 N IGF2BP1 n/a
5 TRCN0000230113 TGAAGATCCTGGCCCATAATA pLKO_005 1121 CDS 100% 15.000 10.500 N IGF2BP1 n/a
6 TRCN0000230112 AGTGGTGAATGTCACCTATTC pLKO_005 645 CDS 100% 10.800 7.560 N IGF2BP1 n/a
7 TRCN0000218799 CTCCAAAGTTCGTATGGTTAT pLKO_005 1623 CDS 100% 10.800 7.560 N IGF2BP1 n/a
8 TRCN0000075148 CCAGGAATAAAGGCTTTGTTT pLKO.1 8030 3UTR 100% 5.625 3.938 N IGF2BP1 n/a
9 TRCN0000096883 GAAACACCTGACTCCAAAGTT pLKO.1 1612 CDS 100% 5.625 3.938 N Igf2bp1 n/a
10 TRCN0000312118 GAAACACCTGACTCCAAAGTT pLKO_005 1612 CDS 100% 5.625 3.938 N Igf2bp1 n/a
11 TRCN0000075152 CCTGGCCCATAATAACTTTGT pLKO.1 1128 CDS 100% 4.950 3.465 N IGF2BP1 n/a
12 TRCN0000075149 GCAGTGGTGAATGTCACCTAT pLKO.1 643 CDS 100% 4.950 3.465 N IGF2BP1 n/a
13 TRCN0000075150 GCGGACTTGGAGAAAGTGTTT pLKO.1 331 CDS 100% 4.950 3.465 N IGF2BP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024022.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.