Transcript: Human XM_017024117.2

PREDICTED: Homo sapiens ring finger protein 157 (RNF157), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF157 (114804)
Length:
5797
CDS:
129..2195

Additional Resources:

NCBI RefSeq record:
XM_017024117.2
NBCI Gene record:
RNF157 (114804)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024117.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016739 GCAGAGGGAAATGATGTTATA pLKO.1 1887 CDS 100% 13.200 18.480 N RNF157 n/a
2 TRCN0000016741 CATCCCGTCTAATTCCGTGTA pLKO.1 176 CDS 100% 4.050 5.670 N RNF157 n/a
3 TRCN0000016738 GCATCCATCCTCAGAGAATAT pLKO.1 1187 CDS 100% 13.200 9.240 N RNF157 n/a
4 TRCN0000016742 GCCACGGAAGAGTTCCAGAAT pLKO.1 540 CDS 100% 4.950 3.465 N RNF157 n/a
5 TRCN0000016740 CAAGATTCTAAGGTGGCTGAA pLKO.1 909 CDS 100% 4.050 2.835 N RNF157 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024117.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.