Transcript: Human XM_017024123.1

PREDICTED: Homo sapiens oxysterol binding protein like 7 (OSBPL7), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OSBPL7 (114881)
Length:
3934
CDS:
344..3010

Additional Resources:

NCBI RefSeq record:
XM_017024123.1
NBCI Gene record:
OSBPL7 (114881)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024123.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157468 GTGGGTGACCAACAATACCTA pLKO.1 2932 CDS 100% 3.000 4.200 N OSBPL7 n/a
2 TRCN0000158085 CATTATGCAACAACCCGGCAA pLKO.1 575 CDS 100% 2.160 3.024 N OSBPL7 n/a
3 TRCN0000157270 GTGGAACATTCTGCGCAACAA pLKO.1 1780 CDS 100% 4.950 3.960 N OSBPL7 n/a
4 TRCN0000157302 CAACAATACCTACTGGAGGCT pLKO.1 2941 CDS 100% 0.660 0.528 N OSBPL7 n/a
5 TRCN0000156398 CAGTTTGCCTTGGAGCTGAAT pLKO.1 2555 CDS 100% 4.950 3.465 N OSBPL7 n/a
6 TRCN0000151258 GCAAGATATGAAGTGGAAGAA pLKO.1 2140 CDS 100% 4.950 3.465 N OSBPL7 n/a
7 TRCN0000156918 GAACAAGGTGACATCCTGCAT pLKO.1 2245 CDS 100% 2.640 1.848 N OSBPL7 n/a
8 TRCN0000152585 GCACAAGAGATACTTTGTGCT pLKO.1 538 CDS 100% 0.264 0.185 N OSBPL7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024123.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09404 pDONR223 100% 94.7% 94.8% None 2418_2555del;2637T>C n/a
Download CSV