Transcript: Human XM_017024293.1

PREDICTED: Homo sapiens dynein axonemal heavy chain 9 (DNAH9), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNAH9 (1770)
Length:
12123
CDS:
95..11482

Additional Resources:

NCBI RefSeq record:
XM_017024293.1
NBCI Gene record:
DNAH9 (1770)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024293.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159565 CGGCAGAAGATTATGACTATA pLKO.1 3293 CDS 100% 13.200 18.480 N DNAH9 n/a
2 TRCN0000161804 CCGAACCTGTATTGTCACTTT pLKO.1 6233 CDS 100% 4.950 6.930 N DNAH9 n/a
3 TRCN0000160748 CCGATCTGTTAGACATCCTTT pLKO.1 2805 CDS 100% 4.950 6.930 N DNAH9 n/a
4 TRCN0000162380 CGGGATAAGATGGTAGAAGAA pLKO.1 6122 CDS 100% 4.950 6.930 N DNAH9 n/a
5 TRCN0000424064 GACCTATGCTTTGCGAGATTT pLKO_005 9562 CDS 100% 13.200 10.560 N DNAH9 n/a
6 TRCN0000425423 GCCAACCTGGATGCGTTTATA pLKO_005 1334 CDS 100% 15.000 10.500 N DNAH9 n/a
7 TRCN0000415727 GCATGAATCAAATCGAGTTTA pLKO_005 6100 CDS 100% 13.200 9.240 N DNAH9 n/a
8 TRCN0000161202 GCCAACCTAATAGACAGCATA pLKO.1 9158 CDS 100% 4.950 3.465 N DNAH9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024293.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.