Transcript: Human XM_017024502.2

PREDICTED: Homo sapiens gasdermin A (GSDMA), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GSDMA (284110)
Length:
1708
CDS:
119..1429

Additional Resources:

NCBI RefSeq record:
XM_017024502.2
NBCI Gene record:
GSDMA (284110)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024502.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244079 GGGCTACAGGGATCCATAAAT pLKO_005 668 CDS 100% 15.000 21.000 N GSDMA n/a
2 TRCN0000244076 CTTACCAAGGCCTCCTAATTT pLKO_005 1412 CDS 100% 15.000 10.500 N GSDMA n/a
3 TRCN0000244075 TCCACCTGCCCAACCATATAT pLKO_005 1568 3UTR 100% 15.000 10.500 N GSDMA n/a
4 TRCN0000244077 CCTCGCCTCTGTGCTCTTTAT pLKO_005 1367 CDS 100% 13.200 9.240 N GSDMA n/a
5 TRCN0000244078 GCAAAGATGAGTGGGATATTC pLKO_005 759 CDS 100% 13.200 9.240 N GSDMA n/a
6 TRCN0000168022 CTGAAGGAGATGCAAGATCAA pLKO.1 536 CDS 100% 4.950 3.465 N GSDMA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024502.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09953 pDONR223 100% 97.8% 97.3% None 382G>T;703_704ins27;914C>A n/a
2 ccsbBroad304_09953 pLX_304 0% 97.8% 97.3% V5 382G>T;703_704ins27;914C>A n/a
Download CSV