Transcript: Human XM_017024784.2

PREDICTED: Homo sapiens BCAS3 microtubule associated cell migration factor (BCAS3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BCAS3 (54828)
Length:
3916
CDS:
55..3210

Additional Resources:

NCBI RefSeq record:
XM_017024784.2
NBCI Gene record:
BCAS3 (54828)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024784.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146565 CACAAATTTCACCCAGCAAAT pLKO.1 1844 CDS 100% 10.800 7.560 N BCAS3 n/a
2 TRCN0000146762 CAGTTATCTCATCCAGTTCAT pLKO.1 2411 CDS 100% 4.950 3.465 N BCAS3 n/a
3 TRCN0000130230 CTTGGTGTTTGTAAGAGCATT pLKO.1 499 CDS 100% 4.950 3.465 N BCAS3 n/a
4 TRCN0000150151 GCAAATAATGCAGGTCTGAAA pLKO.1 1921 CDS 100% 4.950 3.465 N BCAS3 n/a
5 TRCN0000130701 CCACAGTTATCTCATCCAGTT pLKO.1 2408 CDS 100% 4.050 2.835 N BCAS3 n/a
6 TRCN0000127867 GAAACTTTGATGGCTACCGAT pLKO.1 3131 CDS 100% 2.640 1.848 N BCAS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024784.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12092 pDONR223 100% 37.1% 37.1% None 1_1659del;1727_1771del;2559_2837del n/a
2 ccsbBroad304_12092 pLX_304 0% 37.1% 37.1% V5 1_1659del;1727_1771del;2559_2837del n/a
Download CSV