Transcript: Human XM_017024913.1

PREDICTED: Homo sapiens phosphatidylcholine transfer protein (PCTP), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCTP (58488)
Length:
2850
CDS:
424..819

Additional Resources:

NCBI RefSeq record:
XM_017024913.1
NBCI Gene record:
PCTP (58488)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024913.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180594 GATCCGGGTGAAGCAATACAA pLKO.1 654 CDS 100% 5.625 7.875 N PCTP n/a
2 TRCN0000180273 CCCATGTCCAACAGAGACTAT pLKO.1 529 CDS 100% 4.950 6.930 N PCTP n/a
3 TRCN0000425054 AGACTGGACTTTATGAGTATA pLKO_005 350 5UTR 100% 13.200 9.240 N PCTP n/a
4 TRCN0000147488 GCCTTCTTCTACAGTTCAATA pLKO.1 1829 3UTR 100% 13.200 9.240 N PCTP n/a
5 TRCN0000146425 CTGTCAGAACTACCTCAAGAA pLKO.1 1549 3UTR 100% 4.950 3.465 N PCTP n/a
6 TRCN0000148194 GACATCTATATGGACTCAGAT pLKO.1 415 5UTR 100% 4.950 3.465 N PCTP n/a
7 TRCN0000105216 CTGGGAAGTGAAGTACCCTTT pLKO.1 507 CDS 100% 4.050 2.835 N Pctp n/a
8 TRCN0000427310 AGTATGTTAAAGAACTCTATG pLKO_005 455 CDS 100% 10.800 6.480 N PCTP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024913.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08777 pDONR223 100% 57.9% 57.9% None (many diffs) n/a
Download CSV