Transcript: Human XM_017024995.2

PREDICTED: Homo sapiens upstream binding transcription factor (UBTF), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBTF (7343)
Length:
4739
CDS:
188..2533

Additional Resources:

NCBI RefSeq record:
XM_017024995.2
NBCI Gene record:
UBTF (7343)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024995.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235709 CAGGACCGTGCAGCATATAAA pLKO_005 2156 CDS 100% 15.000 21.000 N UBTF n/a
2 TRCN0000220211 CCGTGCAGCATATAAAGAGTA pLKO.1 2161 CDS 100% 4.950 6.930 N UBTF n/a
3 TRCN0000235712 GTCATGTCACTGACCTATTAA pLKO_005 4010 3UTR 100% 15.000 10.500 N UBTF n/a
4 TRCN0000235710 CGATGCTCAGGAACATGTTAA pLKO_005 457 CDS 100% 13.200 9.240 N UBTF n/a
5 TRCN0000235713 GAGATCATGAGAGACTATATC pLKO_005 959 CDS 100% 13.200 9.240 N UBTF n/a
6 TRCN0000235711 GTGAGGAAGTTCCGTACATTG pLKO_005 422 CDS 100% 10.800 7.560 N UBTF n/a
7 TRCN0000220212 CCGTACATTGACAGAATTGAT pLKO.1 433 CDS 100% 5.625 3.938 N UBTF n/a
8 TRCN0000220213 CCTAACCAAGATTCTGTCCAA pLKO.1 610 CDS 100% 2.640 1.848 N UBTF n/a
9 TRCN0000220210 GCCTATCACAAGAAGTGTGAT pLKO.1 1211 CDS 100% 0.495 0.347 N UBTF n/a
10 TRCN0000220209 CCCACTTTCTTTCTTTCTTTA pLKO.1 2640 3UTR 100% 13.200 6.600 Y UBTF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024995.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.