Transcript: Human XM_017025182.1

PREDICTED: Homo sapiens family with sequence similarity 117 member A (FAM117A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM117A (81558)
Length:
3115
CDS:
684..2189

Additional Resources:

NCBI RefSeq record:
XM_017025182.1
NBCI Gene record:
FAM117A (81558)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025182.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369432 ATGGGCTTCATCTTCCGTAAC pLKO_005 2007 CDS 100% 6.000 8.400 N FAM117A n/a
2 TRCN0000369493 ACTTCAGGTCCGGCGTACATT pLKO_005 1076 CDS 100% 5.625 7.875 N FAM117A n/a
3 TRCN0000364740 CTGTATAGGAGGCCCTTATTT pLKO_005 2502 3UTR 100% 15.000 10.500 N FAM117A n/a
4 TRCN0000376494 GCTGCTGAGGATCCTTGATAT pLKO_005 1526 CDS 100% 13.200 9.240 N FAM117A n/a
5 TRCN0000377285 GTAGCTGGGCAGCTCACAATT pLKO_005 2393 3UTR 100% 13.200 9.240 N FAM117A n/a
6 TRCN0000364691 ATCATAGCTACATCTTCAAAC pLKO_005 1819 CDS 100% 10.800 7.560 N FAM117A n/a
7 TRCN0000166909 CAAGAACAAAGTCCATTTCAA pLKO.1 1931 CDS 100% 5.625 3.938 N FAM117A n/a
8 TRCN0000172251 CCTCCAGGAGACCATAAGATA pLKO.1 2585 3UTR 100% 5.625 3.938 N FAM117A n/a
9 TRCN0000167972 CAAGTTGAAGCAACAACTGCA pLKO.1 1295 CDS 100% 0.264 0.185 N FAM117A n/a
10 TRCN0000172865 GACTTCCTGTCCTGACAAGAA pLKO.1 1916 CDS 100% 4.950 2.970 N FAM117A n/a
11 TRCN0000276926 TGGGCTTCATCTTCCGTAATT pLKO_005 2008 CDS 100% 13.200 9.240 N Fam117a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025182.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15174 pDONR223 65% 84.9% 79.4% None (many diffs) n/a
2 ccsbBroad304_15174 pLX_304 0% 84.9% 79.4% V5 (many diffs) n/a
Download CSV