Transcript: Human XM_017025477.2

PREDICTED: Homo sapiens helicase with zinc finger (HELZ), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HELZ (9931)
Length:
13681
CDS:
750..5873

Additional Resources:

NCBI RefSeq record:
XM_017025477.2
NBCI Gene record:
HELZ (9931)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025477.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162533 CACGGTTACATGACCTTCTTT pLKO.1 1417 CDS 100% 5.625 7.875 N HELZ n/a
2 TRCN0000161931 GCTGCTAGACTTGCAACTAAT pLKO.1 6008 3UTR 100% 13.200 10.560 N HELZ n/a
3 TRCN0000160132 CCAAAGTCAATGCTGTTTATT pLKO.1 1630 CDS 100% 15.000 10.500 N HELZ n/a
4 TRCN0000160982 GATGCACAGTTCCCTTTGTTT pLKO.1 5955 3UTR 100% 5.625 3.938 N HELZ n/a
5 TRCN0000162269 CCTGAGAAAGTGCTTAGTGAA pLKO.1 789 CDS 100% 4.950 3.465 N HELZ n/a
6 TRCN0000158502 CCCAGAAAGAAGATATTCTTA pLKO.1 2314 CDS 100% 0.563 0.338 N HELZ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025477.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.