Transcript: Human XM_017025705.2

PREDICTED: Homo sapiens potassium voltage-gated channel modifier subfamily G member 2 (KCNG2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNG2 (26251)
Length:
7705
CDS:
2609..4009

Additional Resources:

NCBI RefSeq record:
XM_017025705.2
NBCI Gene record:
KCNG2 (26251)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025705.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044307 CAGCTATTGGTGGGCCGTCAT pLKO.1 3682 CDS 100% 1.350 1.890 N KCNG2 n/a
2 TRCN0000435032 TGTTCGTGCTGGAGACCGTGT pLKO_005 3261 CDS 100% 0.720 1.008 N KCNG2 n/a
3 TRCN0000044303 GCCACTCAACATCATTGACAT pLKO.1 3355 CDS 100% 4.950 3.465 N KCNG2 n/a
4 TRCN0000413897 TGTGTGACGACTACGACGTGA pLKO_005 2781 CDS 100% 2.640 1.848 N KCNG2 n/a
5 TRCN0000423346 CCGGCACGTCATCATCAACGT pLKO_005 2656 CDS 100% 0.880 0.616 N KCNG2 n/a
6 TRCN0000044306 CCTGAGCACCATGCCGGACAT pLKO.1 3193 CDS 100% 0.000 0.000 N KCNG2 n/a
7 TRCN0000044304 GCGCTCCTACTCCGAGCTCAA pLKO.1 3835 CDS 100% 0.000 0.000 N KCNG2 n/a
8 TRCN0000418589 CTGGTTCTCCTTCGAGTTCCT pLKO_005 3289 CDS 100% 2.640 1.584 N KCNG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025705.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.