Transcript: Human XM_017026033.1

PREDICTED: Homo sapiens carbohydrate sulfotransferase 9 (CHST9), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHST9 (83539)
Length:
9035
CDS:
199..1530

Additional Resources:

NCBI RefSeq record:
XM_017026033.1
NBCI Gene record:
CHST9 (83539)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026033.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422886 GTATTCGGAAAGGCAATTATC pLKO_005 1108 CDS 100% 13.200 18.480 N CHST9 n/a
2 TRCN0000035156 CCGCTTAAATACTTACACCAA pLKO.1 1002 CDS 100% 2.640 3.696 N CHST9 n/a
3 TRCN0000035155 CCTGTGAAGAAGCATTAATTA pLKO.1 1148 CDS 100% 15.000 10.500 N CHST9 n/a
4 TRCN0000035157 GCTACTCCTCTTCATGTATTT pLKO.1 270 CDS 100% 13.200 9.240 N CHST9 n/a
5 TRCN0000430125 GCTAGATAGCTTTGACCTAAA pLKO_005 969 CDS 100% 10.800 7.560 N CHST9 n/a
6 TRCN0000035158 CCAGAATCTATGTAGAAGATA pLKO.1 809 CDS 100% 5.625 3.938 N CHST9 n/a
7 TRCN0000035154 CCCAAGAGAAACGAAGGTCTT pLKO.1 719 CDS 100% 4.050 2.835 N CHST9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026033.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12740 pDONR223 100% 98.8% 98.8% None 1_15del n/a
2 ccsbBroad304_12740 pLX_304 0% 98.8% 98.8% V5 1_15del n/a
Download CSV