Transcript: Human XM_017026299.2

PREDICTED: Homo sapiens sperm acrosome associated 6 (SPACA6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPACA6 (147650)
Length:
3811
CDS:
1707..2681

Additional Resources:

NCBI RefSeq record:
XM_017026299.2
NBCI Gene record:
SPACA6 (147650)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026299.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138747 CGCATCTGCCAGATGTTTGTT pLKO.1 1821 CDS 100% 5.625 3.938 N SPACA6 n/a
2 TRCN0000138551 CCAAAGGAGGAGATCACCTAT pLKO.1 2235 CDS 100% 4.950 3.465 N SPACA6 n/a
3 TRCN0000137605 CAAGCTTGAAGAGTGTGAGGA pLKO.1 1856 CDS 100% 2.640 1.848 N SPACA6 n/a
4 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 2815 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
5 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2926 3UTR 100% 5.625 2.813 Y KLHL30 n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2926 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026299.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.