Transcript: Human XM_017027156.1

PREDICTED: Homo sapiens zinc finger SWIM-type containing 4 (ZSWIM4), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZSWIM4 (65249)
Length:
4276
CDS:
310..3096

Additional Resources:

NCBI RefSeq record:
XM_017027156.1
NBCI Gene record:
ZSWIM4 (65249)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027156.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437815 GCGGATGACTCTGAACGTAAT pLKO_005 2160 CDS 100% 10.800 15.120 N ZSWIM4 n/a
2 TRCN0000149808 GCAAGCCCTGATGAATATCAT pLKO.1 2241 CDS 100% 5.625 7.875 N ZSWIM4 n/a
3 TRCN0000149144 GAGACCTGTATCTTGGTGTTT pLKO.1 3859 3UTR 100% 4.950 6.930 N ZSWIM4 n/a
4 TRCN0000436005 CTAAGTCAATGTAGCACATTT pLKO_005 3458 3UTR 100% 13.200 9.240 N ZSWIM4 n/a
5 TRCN0000442194 CCGAGATCAACTTGGTGAATG pLKO_005 419 CDS 100% 10.800 7.560 N ZSWIM4 n/a
6 TRCN0000127539 CCCAATGCTGTCCGATATTCT pLKO.1 2754 CDS 100% 5.625 3.938 N ZSWIM4 n/a
7 TRCN0000130420 GAACCTCAAACAGACCTACAA pLKO.1 3030 CDS 100% 4.950 3.465 N ZSWIM4 n/a
8 TRCN0000147923 GCAAGAAGAAACTCATGCTTT pLKO.1 3053 CDS 100% 4.950 3.465 N ZSWIM4 n/a
9 TRCN0000146528 GTTCTCACAGTTCTTGGAGAA pLKO.1 3012 CDS 100% 0.405 0.243 N ZSWIM4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027156.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.