Transcript: Human XM_017027239.1

PREDICTED: Homo sapiens zinc finger protein 121 (ZNF121), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF121 (7675)
Length:
1862
CDS:
407..1579

Additional Resources:

NCBI RefSeq record:
XM_017027239.1
NBCI Gene record:
ZNF121 (7675)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027239.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117780 AGAACGTGGATAGGAGACAAA pLKO.1 644 CDS 100% 4.950 6.930 N ZNF121 n/a
2 TRCN0000117778 GCCTTAATGCACACATGGGAA pLKO.1 480 CDS 100% 2.640 2.112 N ZNF121 n/a
3 TRCN0000117779 GCCTTTGTTGATCAGTCACAT pLKO.1 692 CDS 100% 4.950 3.465 N ZNF121 n/a
4 TRCN0000117781 CTGTGTTGAATCAGTGCAGAA pLKO.1 591 CDS 100% 4.050 2.430 N ZNF121 n/a
5 TRCN0000151775 CCCTATGAATGTAAGGAATGT pLKO.1 917 CDS 100% 4.950 2.475 Y ZNF829 n/a
6 TRCN0000117777 CGAAGACATGAAAGAACTCAT pLKO.1 1719 3UTR 100% 4.950 2.475 Y ZNF121 n/a
7 TRCN0000147970 GAATGTAAGGAATGTGGGAAA pLKO.1 923 CDS 100% 4.050 2.025 Y ZNF700 n/a
8 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 1493 CDS 100% 15.000 7.500 Y ZNF443 n/a
9 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 1493 CDS 100% 15.000 7.500 Y Zfp97 n/a
10 TRCN0000160334 CCTATGAATGTAAGGAATGTA pLKO.1 918 CDS 100% 5.625 2.813 Y ZNF570 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027239.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.