Transcript: Human XM_017027682.2

PREDICTED: Homo sapiens RIPOR family member 3 (RIPOR3), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RIPOR3 (140876)
Length:
2259
CDS:
466..2259

Additional Resources:

NCBI RefSeq record:
XM_017027682.2
NBCI Gene record:
RIPOR3 (140876)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172812 GAGGATCGCAAAGTCCATCAA pLKO.1 579 CDS 100% 4.950 6.930 N RIPOR3 n/a
2 TRCN0000168264 CACATTCGGAAGATGGAGTTT pLKO.1 859 CDS 100% 4.950 3.960 N RIPOR3 n/a
3 TRCN0000172788 GCATGAGAACCTGGACATCAA pLKO.1 1254 CDS 100% 4.950 3.465 N RIPOR3 n/a
4 TRCN0000168631 GATGGAGTTTCACATCAGCAA pLKO.1 870 CDS 100% 2.640 1.848 N RIPOR3 n/a
5 TRCN0000173076 CCAGCAGGTGAAGAAGATCTT pLKO.1 690 CDS 100% 4.950 2.970 N RIPOR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.