Transcript: Human XM_017027759.1

PREDICTED: Homo sapiens activity dependent neuroprotector homeobox (ADNP), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADNP (23394)
Length:
5771
CDS:
106..3414

Additional Resources:

NCBI RefSeq record:
XM_017027759.1
NBCI Gene record:
ADNP (23394)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027759.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426774 ATCGAAGACCATGAACGTATA pLKO_005 826 CDS 100% 10.800 15.120 N ADNP n/a
2 TRCN0000304335 CAAGCTGCAGTGCCCTATAAA pLKO_005 1933 CDS 100% 15.000 10.500 N Adnp n/a
3 TRCN0000020741 GCCATGATTGGGCACACAAAT pLKO.1 862 CDS 100% 13.200 9.240 N ADNP n/a
4 TRCN0000020739 GCCCGAGAAGAGAGTAGTATT pLKO.1 748 CDS 100% 13.200 9.240 N ADNP n/a
5 TRCN0000419729 TAAGCTGGTGACTCATGAATA pLKO_005 3640 3UTR 100% 13.200 9.240 N ADNP n/a
6 TRCN0000416707 TGGCAGCTTAGCCGGAGTTAA pLKO_005 3372 CDS 100% 13.200 9.240 N ADNP n/a
7 TRCN0000430216 GTGGTTATTTCTAAGTCTATG pLKO_005 3552 3UTR 100% 10.800 7.560 N ADNP n/a
8 TRCN0000425391 TGAGAATGATGAGCGCTTATC pLKO_005 3258 CDS 100% 10.800 7.560 N ADNP n/a
9 TRCN0000020743 CGCACTTACGAGCAAATGGAA pLKO.1 2254 CDS 100% 3.000 2.100 N ADNP n/a
10 TRCN0000020740 GCCTCAACTATCACTCTGCAT pLKO.1 2134 CDS 100% 2.640 1.848 N ADNP n/a
11 TRCN0000020742 CCAACCAAACTAATGCACAAT pLKO.1 2938 CDS 100% 4.950 2.970 N ADNP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027759.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.