Transcript: Human XM_017027838.1

PREDICTED: Homo sapiens visual system homeobox 1 (VSX1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VSX1 (30813)
Length:
3331
CDS:
1..657

Additional Resources:

NCBI RefSeq record:
XM_017027838.1
NBCI Gene record:
VSX1 (30813)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027838.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018191 AGCCAGTCTGAAGACAGGAAT pLKO.1 433 CDS 100% 4.950 3.465 N VSX1 n/a
2 TRCN0000018188 CGAGAAATGCTGGCTGTGAAA pLKO.1 580 CDS 100% 4.950 3.465 N VSX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027838.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03133 pDONR223 100% 58.9% 57.8% None (many diffs) n/a
2 ccsbBroad304_03133 pLX_304 0% 58.9% 57.8% V5 (many diffs) n/a
3 TRCN0000466972 TGGCTTTTGCAAAACTGACTTGGT pLX_317 30.7% 58.9% 57.8% V5 (many diffs) n/a
Download CSV