Transcript: Human XM_017028003.1

PREDICTED: Homo sapiens potassium two pore domain channel subfamily K member 15 (KCNK15), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNK15 (60598)
Length:
2410
CDS:
97..753

Additional Resources:

NCBI RefSeq record:
XM_017028003.1
NBCI Gene record:
KCNK15 (60598)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028003.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414013 GTCCTGTGCACCCTGTGTTAC pLKO_005 340 CDS 100% 3.600 2.520 N KCNK15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028003.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroad304_15128 pLX_304 64.9% 32.6% 25.4% V5 (many diffs) n/a
2 TRCN0000476330 CCCCCTATGACATTCAAGTCAAAG pLX_317 30.8% 32.5% 25.6% V5 (many diffs) n/a
3 ccsbBroadEn_15128 pDONR223 76.6% 32.5% 25.6% None (many diffs) n/a
Download CSV