Transcript: Human XM_017028018.2

PREDICTED: Homo sapiens GDNF inducible zinc finger protein 1 (GZF1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GZF1 (64412)
Length:
7004
CDS:
61..2094

Additional Resources:

NCBI RefSeq record:
XM_017028018.2
NBCI Gene record:
GZF1 (64412)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028018.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433050 GTATGTGCTAATCGTTCTAAT pLKO_005 2414 3UTR 100% 13.200 18.480 N GZF1 n/a
2 TRCN0000418269 GTGGATGGTACTAGGACTAAT pLKO_005 268 CDS 100% 13.200 18.480 N GZF1 n/a
3 TRCN0000422393 TGCTAACTTGCACGGCTTTAT pLKO_005 2286 3UTR 100% 13.200 18.480 N GZF1 n/a
4 TRCN0000444821 ACGGACATTCACCGACAAGTC pLKO_005 1803 CDS 100% 4.050 5.670 N GZF1 n/a
5 TRCN0000427919 GCAACTTTAAGTGCAGCATTT pLKO_005 1004 CDS 100% 10.800 8.640 N GZF1 n/a
6 TRCN0000018956 CCACATGCTGATTTATCATAA pLKO.1 1485 CDS 100% 13.200 9.240 N GZF1 n/a
7 TRCN0000435052 TTGCTTCTAAGGAGTACTTAA pLKO_005 1559 CDS 100% 13.200 9.240 N GZF1 n/a
8 TRCN0000424384 GATGAATGTGGTGCAAGATTC pLKO_005 1456 CDS 100% 10.800 7.560 N GZF1 n/a
9 TRCN0000418236 AGATGTTAGAGTCAGTACTTT pLKO_005 452 CDS 100% 5.625 3.938 N GZF1 n/a
10 TRCN0000018957 GCTGACTTTGCTTCATTTCTT pLKO.1 313 CDS 100% 5.625 3.938 N GZF1 n/a
11 TRCN0000412361 AGAATCCATACTGGATCCAAA pLKO_005 1591 CDS 100% 4.950 3.465 N GZF1 n/a
12 TRCN0000018955 CCGAAGAAGTCCAAGGACAAA pLKO.1 652 CDS 100% 4.950 3.465 N GZF1 n/a
13 TRCN0000018958 CGAAGAGTATGTGTCATCCAA pLKO.1 1892 CDS 100% 3.000 2.100 N GZF1 n/a
14 TRCN0000426317 CAAGAAGAAAGAGGTAGTTAA pLKO_005 678 CDS 100% 13.200 7.920 N GZF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028018.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.