Transcript: Human XM_017028021.2

PREDICTED: Homo sapiens synaptosome associated protein 25 (SNAP25), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SNAP25 (6616)
Length:
2086
CDS:
243..863

Additional Resources:

NCBI RefSeq record:
XM_017028021.2
NBCI Gene record:
SNAP25 (6616)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028021.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381464 TTCATCCGCAGGGTAACAAAT pLKO_005 639 CDS 100% 13.200 18.480 N SNAP25 n/a
2 TRCN0000156232 CCAACCAACGTGCAACAAAGA pLKO.1 826 CDS 100% 4.950 6.930 N SNAP25 n/a
3 TRCN0000343626 CCAACCAACGTGCAACAAAGA pLKO_005 826 CDS 100% 4.950 6.930 N SNAP25 n/a
4 TRCN0000151472 CCCAACAATACTTTGTGTCTT pLKO.1 1011 3UTR 100% 4.950 6.930 N SNAP25 n/a
5 TRCN0000155722 CGATACACAGAATCGCCAGAT pLKO.1 755 CDS 100% 4.050 3.240 N SNAP25 n/a
6 TRCN0000343625 CGATACACAGAATCGCCAGAT pLKO_005 755 CDS 100% 4.050 3.240 N SNAP25 n/a
7 TRCN0000382191 GATGCTGGTATCAGGACTTTG pLKO_005 363 CDS 100% 10.800 7.560 N SNAP25 n/a
8 TRCN0000151891 CCATATCAACCAAGACATGAA pLKO.1 437 CDS 100% 4.950 3.465 N SNAP25 n/a
9 TRCN0000150536 GAACCATATCAACCAAGACAT pLKO.1 434 CDS 100% 4.950 3.465 N SNAP25 n/a
10 TRCN0000343687 GAACCATATCAACCAAGACAT pLKO_005 434 CDS 100% 4.950 3.465 N SNAP25 n/a
11 TRCN0000154494 GACATGAAGGAGGCTGAGAAA pLKO.1 450 CDS 100% 4.950 3.465 N SNAP25 n/a
12 TRCN0000348198 GATGCTGGGAAGTGGTTAAAT pLKO_005 845 CDS 100% 15.000 9.000 N Snap25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028021.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.