Transcript: Human XM_017028416.2

PREDICTED: Homo sapiens SR-related CTD associated factor 4 (SCAF4), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCAF4 (57466)
Length:
3998
CDS:
408..3782

Additional Resources:

NCBI RefSeq record:
XM_017028416.2
NBCI Gene record:
SCAF4 (57466)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028416.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431193 CCGTAATGATGATAGAGATAA pLKO_005 3392 CDS 100% 13.200 18.480 N SCAF4 n/a
2 TRCN0000415295 TTTGGGCCAAGATTCTCTAAA pLKO_005 657 CDS 100% 13.200 10.560 N SCAF4 n/a
3 TRCN0000151785 CTCATCACTAAAGCTGCTATT pLKO.1 489 CDS 100% 10.800 8.640 N SCAF4 n/a
4 TRCN0000430726 AGGAATAAAGGCAGATTATAA pLKO_005 2153 CDS 100% 15.000 10.500 N SCAF4 n/a
5 TRCN0000427653 GAACTTGGTGTTACTTATATT pLKO_005 2190 CDS 100% 15.000 10.500 N SCAF4 n/a
6 TRCN0000416807 GGTGTACAGATGCTGTATTAT pLKO_005 3837 3UTR 100% 15.000 10.500 N SCAF4 n/a
7 TRCN0000428259 GTGAACCAGAAATCCATAAAG pLKO_005 2112 CDS 100% 13.200 9.240 N SCAF4 n/a
8 TRCN0000435270 TTGATTGCTTCCCTTCTATTT pLKO_005 3913 3UTR 100% 13.200 9.240 N SCAF4 n/a
9 TRCN0000155616 CCCGATCTCGATCTCAAGAAA pLKO.1 1825 CDS 100% 5.625 3.938 N SCAF4 n/a
10 TRCN0000150337 CTCAGTTAAAGACAACTCCTA pLKO.1 1102 CDS 100% 2.640 1.848 N SCAF4 n/a
11 TRCN0000179025 CGTCATCAGTTTGGAACTGAT pLKO.1 627 CDS 100% 0.495 0.347 N SCAF4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028416.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.