Transcript: Human XM_017028474.1

PREDICTED: Homo sapiens nuclear receptor interacting protein 1 (NRIP1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NRIP1 (8204)
Length:
7314
CDS:
357..3833

Additional Resources:

NCBI RefSeq record:
XM_017028474.1
NBCI Gene record:
NRIP1 (8204)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028474.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276137 ACCGATAGGTATGATTGATAG pLKO_005 2339 CDS 100% 10.800 15.120 N NRIP1 n/a
2 TRCN0000276192 GATGTGCACCAGGATTCTATT pLKO_005 384 CDS 100% 13.200 10.560 N NRIP1 n/a
3 TRCN0000019781 GCCATCTTAATGGTCAGGCAA pLKO.1 1324 CDS 100% 2.640 2.112 N NRIP1 n/a
4 TRCN0000019783 GCTGGGCATAATGAAGAGGAT pLKO.1 480 CDS 100% 2.640 2.112 N NRIP1 n/a
5 TRCN0000276197 TGCTGATTCACAGCTTATTAT pLKO_005 4287 3UTR 100% 15.000 10.500 N NRIP1 n/a
6 TRCN0000276135 TTACCTAGAAGGATTACTAAT pLKO_005 413 CDS 100% 13.200 9.240 N NRIP1 n/a
7 TRCN0000019779 GCGGAGAAGAATGAGTATGAA pLKO.1 3501 CDS 100% 5.625 3.938 N NRIP1 n/a
8 TRCN0000285495 GCGGAGAAGAATGAGTATGAA pLKO_005 3501 CDS 100% 5.625 3.938 N NRIP1 n/a
9 TRCN0000019780 GCTAACAAATACTGCATCTAA pLKO.1 2126 CDS 100% 5.625 3.938 N NRIP1 n/a
10 TRCN0000019782 GCTGCAAGATTACAGGCTGTT pLKO.1 1065 CDS 100% 4.050 2.835 N NRIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028474.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07208 pDONR223 100% 99.9% 99.9% None 2861G>T n/a
Download CSV