Transcript: Human XM_017028794.1

PREDICTED: Homo sapiens solute carrier family 35 member E4 (SLC35E4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC35E4 (339665)
Length:
3643
CDS:
1729..2781

Additional Resources:

NCBI RefSeq record:
XM_017028794.1
NBCI Gene record:
SLC35E4 (339665)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028794.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044929 CGCACTCACTCTTTCAGGAAT pLKO.1 2673 CDS 100% 4.950 6.930 N SLC35E4 n/a
2 TRCN0000044930 CCTTTACCACAACTGCGAGTT pLKO.1 2697 CDS 100% 4.050 5.670 N SLC35E4 n/a
3 TRCN0000438343 TAAGCCAAGATCGCATGCTAC pLKO_005 3091 3UTR 100% 4.050 5.670 N SLC35E4 n/a
4 TRCN0000434867 ATGACCTCAGCCGAAGTAGGA pLKO_005 1765 CDS 100% 2.640 3.696 N SLC35E4 n/a
5 TRCN0000440793 ACTCAAGTCGGTTCAGCAAAG pLKO_005 2328 CDS 100% 6.000 4.800 N SLC35E4 n/a
6 TRCN0000044928 GCCTCCTGTCTGTTCTCTATA pLKO.1 2513 CDS 100% 13.200 9.240 N SLC35E4 n/a
7 TRCN0000044931 ACCTGGCACAACTGGTTACTA pLKO.1 2129 CDS 100% 5.625 3.938 N SLC35E4 n/a
8 TRCN0000069201 CAGCATGTCAAGCCTCAACAA pLKO.1 1911 CDS 100% 4.950 3.465 N Slc35e4 n/a
9 TRCN0000303021 CAGCATGTCAAGCCTCAACAA pLKO_005 1911 CDS 100% 4.950 3.465 N Slc35e4 n/a
10 TRCN0000044932 GTCAAGCCTCAACAAGTGGAT pLKO.1 1917 CDS 100% 2.640 1.848 N SLC35E4 n/a
11 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 2885 3UTR 100% 4.950 2.475 Y NPHS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028794.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.