Transcript: Human XM_017029220.2

PREDICTED: Homo sapiens Scm polycomb group protein like 2 (SCML2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCML2 (10389)
Length:
2815
CDS:
65..2167

Additional Resources:

NCBI RefSeq record:
XM_017029220.2
NBCI Gene record:
SCML2 (10389)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256356 CAGGAGATCAAGTCGAATTAA pLKO_005 904 CDS 100% 15.000 21.000 N SCML2 n/a
2 TRCN0000019397 GCGACCATTGGAGATGTTAAA pLKO.1 638 CDS 100% 13.200 18.480 N SCML2 n/a
3 TRCN0000256354 GTATGTATTGCTACGGTTATT pLKO_005 302 CDS 100% 13.200 18.480 N SCML2 n/a
4 TRCN0000256353 ACAGGTTAGTATTGGCATATT pLKO_005 2402 3UTR 100% 13.200 9.240 N SCML2 n/a
5 TRCN0000256355 CCAGTGAACAGTGCATCATTT pLKO_005 1376 CDS 100% 13.200 9.240 N SCML2 n/a
6 TRCN0000256357 TTCCACTGGGAGGAGTATTTG pLKO_005 161 CDS 100% 13.200 9.240 N SCML2 n/a
7 TRCN0000019396 CCTCAGCAAACTGTACCATAT pLKO.1 1562 CDS 100% 10.800 7.560 N SCML2 n/a
8 TRCN0000019394 CCCATGAAGTTAAATTCCAAA pLKO.1 1848 CDS 100% 4.950 3.465 N SCML2 n/a
9 TRCN0000019395 GCCACATTATTTAAGAAGGAA pLKO.1 533 CDS 100% 3.000 2.100 N SCML2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.