Transcript: Human XM_017029334.1

PREDICTED: Homo sapiens dystrophin related protein 2 (DRP2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DRP2 (1821)
Length:
7198
CDS:
1487..3322

Additional Resources:

NCBI RefSeq record:
XM_017029334.1
NBCI Gene record:
DRP2 (1821)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029334.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053580 CGCTTGGACCTGGTAACTTTA pLKO.1 1697 CDS 100% 13.200 18.480 N DRP2 n/a
2 TRCN0000420653 GAGCACATCCAGGCTATTAAG pLKO_005 1335 5UTR 100% 13.200 18.480 N DRP2 n/a
3 TRCN0000418372 GTTCGAGATCAGCCCTTTAAG pLKO_005 3557 3UTR 100% 13.200 18.480 N DRP2 n/a
4 TRCN0000053581 CCCGTATCCTTCGGCAACATA pLKO.1 2964 CDS 100% 5.625 7.875 N DRP2 n/a
5 TRCN0000108701 GCCATGAATCTGTGTTGGAAT pLKO.1 759 5UTR 100% 4.950 6.930 N Drp2 n/a
6 TRCN0000429460 GGACTTTGCCACAACCTTAAA pLKO_005 2449 CDS 100% 13.200 10.560 N DRP2 n/a
7 TRCN0000419350 GAAAGAGAGAAGCCTAATTAC pLKO_005 3696 3UTR 100% 13.200 9.240 N DRP2 n/a
8 TRCN0000053582 CCTCATTCTGAGAGCAAAGAT pLKO.1 1068 5UTR 100% 5.625 3.938 N DRP2 n/a
9 TRCN0000053579 CCTAAGCCTAAAGCTGTTGAA pLKO.1 701 5UTR 100% 4.950 3.465 N DRP2 n/a
10 TRCN0000053578 GCATCAGACCAAGTGCTCTAT pLKO.1 2263 CDS 100% 4.950 2.970 N DRP2 n/a
11 TRCN0000108704 GCTGAGCAAGTGAAGCATCAA pLKO.1 2249 CDS 100% 4.950 3.465 N Drp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029334.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.