Transcript: Human XM_017029489.1

PREDICTED: Homo sapiens immunoglobulin binding protein 1 (IGBP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IGBP1 (3476)
Length:
1862
CDS:
500..1519

Additional Resources:

NCBI RefSeq record:
XM_017029489.1
NBCI Gene record:
IGBP1 (3476)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029489.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039967 CTCGACTTGTTCAGCCGAAAT pLKO.1 674 CDS 100% 10.800 15.120 N IGBP1 n/a
2 TRCN0000039966 GCATCTCAAAGACAGGCTAAA pLKO.1 953 CDS 100% 10.800 7.560 N IGBP1 n/a
3 TRCN0000288669 GCATCTCAAAGACAGGCTAAA pLKO_005 953 CDS 100% 10.800 7.560 N IGBP1 n/a
4 TRCN0000010293 GACAGTTACTGGACGAAGTAG pLKO.1 558 CDS 100% 4.950 3.465 N IGBP1 n/a
5 TRCN0000295827 GACAGTTACTGGACGAAGTAG pLKO_005 558 CDS 100% 4.950 3.465 N IGBP1 n/a
6 TRCN0000039965 GCTCAGCAACAGGAAGAACAA pLKO.1 1388 CDS 100% 4.950 3.465 N IGBP1 n/a
7 TRCN0000288610 GCTCAGCAACAGGAAGAACAA pLKO_005 1388 CDS 100% 4.950 3.465 N IGBP1 n/a
8 TRCN0000039963 GTCAAGTGATTAAGTGTGTAT pLKO.1 1662 3UTR 100% 4.950 3.465 N IGBP1 n/a
9 TRCN0000010295 TGCTTCAGCTCTGTACAACGA pLKO.1 1602 3UTR 100% 2.640 1.848 N IGBP1 n/a
10 TRCN0000295883 TGCTTCAGCTCTGTACAACGA pLKO_005 1602 3UTR 100% 2.640 1.848 N IGBP1 n/a
11 TRCN0000039964 CCTCCAGTGAAACCCTTCATT pLKO.1 1211 CDS 100% 5.625 2.813 Y IGBP1 n/a
12 TRCN0000288670 CCTCCAGTGAAACCCTTCATT pLKO_005 1211 CDS 100% 5.625 2.813 Y IGBP1 n/a
13 TRCN0000010294 CAACTATGACGGTGAGTGACT pLKO.1 1287 CDS 100% 2.640 1.320 Y IGBP1 n/a
14 TRCN0000067183 CCAGGAAATAAAGATCCTGAA pLKO.1 1135 CDS 100% 0.405 0.203 Y Igbp1 n/a
15 TRCN0000325761 CCAGGAAATAAAGATCCTGAA pLKO_005 1135 CDS 100% 0.405 0.203 Y Igbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029489.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.