Transcript: Human XM_017029543.1

PREDICTED: Homo sapiens SPANX family member N4 (SPANXN4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPANXN4 (441525)
Length:
657
CDS:
88..561

Additional Resources:

NCBI RefSeq record:
XM_017029543.1
NBCI Gene record:
SPANXN4 (441525)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029543.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254465 TTACTGCAGGAAGAATAAGAA pLKO_005 249 CDS 100% 5.625 3.938 N SPANXN4 n/a
2 TRCN0000254467 AGAGTTTGAAAGAGACAGAAA pLKO_005 203 CDS 100% 4.950 3.465 N SPANXN4 n/a
3 TRCN0000265557 CCCTGAACAGAGTTTGAAAGA pLKO_005 195 CDS 100% 4.950 3.465 N SPANXN4 n/a
4 TRCN0000254466 AGAAGAAGAATCTGCACAGAG pLKO_005 167 CDS 100% 4.050 2.835 N SPANXN4 n/a
5 TRCN0000183740 CTGAACAGAGTTTGAAAGAGA pLKO.1 197 CDS 100% 3.000 2.100 N SPANXN4 n/a
6 TRCN0000265547 TGACAAGAAGAAGAAGAATCT pLKO_005 159 CDS 100% 4.950 2.970 N SPANXN4 n/a
7 TRCN0000183576 GAACAGAGTTTGAAAGAGACA pLKO.1 199 CDS 100% 2.640 1.584 N SPANXN4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029543.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05683 pDONR223 100% 62.4% 61.1% None (many diffs) n/a
2 ccsbBroad304_05683 pLX_304 0% 62.4% 61.1% V5 (many diffs) n/a
Download CSV