Transcript: Human XM_017029682.2

PREDICTED: Homo sapiens shroom family member 4 (SHROOM4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SHROOM4 (57477)
Length:
8104
CDS:
132..4727

Additional Resources:

NCBI RefSeq record:
XM_017029682.2
NBCI Gene record:
SHROOM4 (57477)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143413 CGGTGTTCAGTTTGCTATCAT pLKO.1 2928 CDS 100% 5.625 7.875 N SHROOM4 n/a
2 TRCN0000143813 GCTACCAATCTGCGTAATGAA pLKO.1 1896 CDS 100% 5.625 7.875 N SHROOM4 n/a
3 TRCN0000143348 GCTTTGTACTAGGACACCAAA pLKO.1 5032 3UTR 100% 4.950 6.930 N SHROOM4 n/a
4 TRCN0000122755 CCGTCTGCAAATCCAATGAAT pLKO.1 4309 CDS 100% 5.625 4.500 N SHROOM4 n/a
5 TRCN0000143245 GCCACAGACCAATCATATCAT pLKO.1 2646 CDS 100% 5.625 4.500 N SHROOM4 n/a
6 TRCN0000141924 CGCAAGGAACCCTAATAGGTT pLKO.1 1085 CDS 100% 3.000 2.400 N SHROOM4 n/a
7 TRCN0000143288 GCAGTTTCTCAGCAAGTAGAT pLKO.1 4796 3UTR 100% 4.950 3.465 N SHROOM4 n/a
8 TRCN0000142833 CCATATCATCAACAGCCTCTA pLKO.1 5076 3UTR 100% 4.050 2.835 N SHROOM4 n/a
9 TRCN0000190517 GAGGAGGAAGAAGAAGAAGAA pLKO.1 3651 CDS 100% 4.950 2.475 Y G430095P16Rik n/a
10 TRCN0000145134 GAAGAAGAAGAAGAAGAGGAA pLKO.1 3657 CDS 100% 2.640 1.320 Y ARL6IP4 n/a
11 TRCN0000235177 ACCTCTTACTCAGCTTATTAT pLKO_005 4056 CDS 100% 15.000 10.500 N Shroom4 n/a
12 TRCN0000121617 GAAGAAGAAGAAGAGGAAGAA pLKO.1 3660 CDS 100% 4.950 2.475 Y ARL6IP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.