Transcript: Human XM_017030082.1

PREDICTED: Homo sapiens protocadherin 11 Y-linked (PCDH11Y), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCDH11Y (83259)
Length:
4930
CDS:
580..3693

Additional Resources:

NCBI RefSeq record:
XM_017030082.1
NBCI Gene record:
PCDH11Y (83259)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017030082.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056286 GCTGCTTAATGTTGTCACTAT pLKO.1 3285 CDS 100% 4.950 2.970 N PCDH11Y n/a
2 TRCN0000417523 GTAATCTGGCAATGGAAATTT pLKO_005 3888 3UTR 100% 15.000 7.500 Y PCDH11Y n/a
3 TRCN0000056357 CCCATCCATTGACATAAGATA pLKO.1 1698 CDS 100% 5.625 2.813 Y PCDH11X n/a
4 TRCN0000056287 CCAAGGGATGAGCATTGCTTT pLKO.1 943 CDS 100% 4.950 2.475 Y PCDH11Y n/a
5 TRCN0000056285 CCTGTCAATGACACAGTTGTT pLKO.1 1729 CDS 100% 4.950 2.475 Y PCDH11Y n/a
6 TRCN0000056283 CCTTCCAAATTCAGCCTGAAA pLKO.1 3482 CDS 100% 4.950 2.475 Y PCDH11Y n/a
7 TRCN0000073413 CGCCTGTAATTCCAGCACTTT pLKO.1 4312 3UTR 100% 4.950 2.475 Y LILRB1 n/a
8 TRCN0000056356 GCAGATGATAATGATGAAGAA pLKO.1 3228 CDS 100% 4.950 2.475 Y PCDH11X n/a
9 TRCN0000056284 GCCAGTATTCAGTAATCAGTT pLKO.1 1869 CDS 100% 4.950 2.475 Y PCDH11Y n/a
10 TRCN0000424308 GTGAGCTGAACTAGCCAAACT pLKO_005 4111 3UTR 100% 4.950 2.475 Y PCDH11Y n/a
11 TRCN0000418182 TGCAATTACTTGCCCTGTCTG pLKO_005 4050 3UTR 100% 4.050 2.025 Y PCDH11Y n/a
12 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4863 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017030082.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.