Transcript: Mouse XM_017312278.1

PREDICTED: Mus musculus CD177 antigen (Cd177), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cd177 (68891)
Length:
2185
CDS:
49..1950

Additional Resources:

NCBI RefSeq record:
XM_017312278.1
NBCI Gene record:
Cd177 (68891)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312278.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438851 AGGCGATTGGGACCTTGTATA pLKO_005 632 CDS 100% 13.200 18.480 N Cd177 n/a
2 TRCN0000109882 GCTCCTGTATAATGGACCCAA pLKO.1 231 CDS 100% 2.640 3.696 N Cd177 n/a
3 TRCN0000109881 CCCATGTGTGTAGAGTTATTT pLKO.1 1612 CDS 100% 15.000 10.500 N Cd177 n/a
4 TRCN0000412903 TATGAAACAGTGATGCTAATA pLKO_005 790 CDS 100% 13.200 9.240 N Cd177 n/a
5 TRCN0000109883 GCACCTGATGAGATTTGTCAA pLKO.1 1351 CDS 100% 4.950 3.465 N Cd177 n/a
6 TRCN0000109855 CCATTTCCTGACCATTCTTAA pLKO.1 1953 3UTR 100% 13.200 6.600 Y Gm4763 n/a
7 TRCN0000109880 TGACCATTCTTAATCCCTCTT pLKO.1 1961 3UTR 100% 4.050 2.025 Y Cd177 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312278.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.