Transcript: Mouse XM_017312400.1

PREDICTED: Mus musculus pyroglutamyl-peptidase I-like (Pgpep1l), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pgpep1l (78444)
Length:
1174
CDS:
147..755

Additional Resources:

NCBI RefSeq record:
XM_017312400.1
NBCI Gene record:
Pgpep1l (78444)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312400.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031056 CATCTGCGATTACACCTACTA pLKO.1 1085 3UTR 100% 4.950 6.930 N Pgpep1l n/a
2 TRCN0000031058 GAGAATGTCGAAGTGGCCTTT pLKO.1 525 CDS 100% 4.050 5.670 N Pgpep1l n/a
3 TRCN0000445377 AGTGAGGCTGTCTGTTGTCAA pLKO_005 473 CDS 100% 4.950 3.465 N Pgpep1l n/a
4 TRCN0000031055 TGTGGTAAGAACCGAGGCTAT pLKO.1 390 CDS 100% 4.050 2.835 N Pgpep1l n/a
5 TRCN0000015008 CCAACCAACCAACCAACCAAA pLKO.1 18 5UTR 100% 4.950 2.475 Y HMBOX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312400.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.