Transcript: Mouse XM_017312582.1

PREDICTED: Mus musculus potassium channel, subfamily U, member 1 (Kcnu1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcnu1 (16532)
Length:
3374
CDS:
33..3233

Additional Resources:

NCBI RefSeq record:
XM_017312582.1
NBCI Gene record:
Kcnu1 (16532)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312582.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068330 CCCTCCAACATCCACTTTATT pLKO.1 2679 CDS 100% 15.000 10.500 N Kcnu1 n/a
2 TRCN0000068328 CGCTTCTATGTCAACAGAAAT pLKO.1 2012 CDS 100% 13.200 9.240 N Kcnu1 n/a
3 TRCN0000068331 CGCTTTCTTTAGCTTCTATTT pLKO.1 470 CDS 100% 13.200 9.240 N Kcnu1 n/a
4 TRCN0000068332 GCAGAGCTAAAGCTCGGATTT pLKO.1 1488 CDS 100% 10.800 7.560 N Kcnu1 n/a
5 TRCN0000068329 GCCTGATTCTAGCCAACCATT pLKO.1 1294 CDS 100% 4.950 3.465 N Kcnu1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312582.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.