Transcript: Mouse XM_017312674.1

PREDICTED: Mus musculus transmembrane phosphatase with tensin homology (Tpte), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tpte (234129)
Length:
4233
CDS:
504..2399

Additional Resources:

NCBI RefSeq record:
XM_017312674.1
NBCI Gene record:
Tpte (234129)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312674.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420155 AGAAGGGAGACGGCGCTATTT pLKO_005 1304 CDS 100% 13.200 18.480 N Tpte n/a
2 TRCN0000220933 GCGTATTATTGCCATGTCATT pLKO.1 1595 CDS 100% 4.950 6.930 N Tpte n/a
3 TRCN0000220936 CCTGGAAGTACAAATCATAAT pLKO.1 2165 CDS 100% 13.200 9.240 N Tpte n/a
4 TRCN0000220932 CGAATTGGATAATACCCATAA pLKO.1 3971 3UTR 100% 10.800 7.560 N Tpte n/a
5 TRCN0000413304 CTATCAAGTCTACAATCTATG pLKO_005 1697 CDS 100% 10.800 7.560 N Tpte n/a
6 TRCN0000220935 GCCTTCAGAATATTTGGAATT pLKO.1 1140 CDS 100% 0.000 0.000 N Tpte n/a
7 TRCN0000220934 GCCTGCAAATATTTACAAGAT pLKO.1 563 CDS 100% 4.950 2.970 N Tpte n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312674.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.