Transcript: Mouse XM_017312729.1

PREDICTED: Mus musculus inositol polyphosphate-4-phosphatase, type II (Inpp4b), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Inpp4b (234515)
Length:
3689
CDS:
696..3365

Additional Resources:

NCBI RefSeq record:
XM_017312729.1
NBCI Gene record:
Inpp4b (234515)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312729.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080644 CGTTCTGTTTAATGTCGGAAT pLKO.1 2933 CDS 100% 4.050 5.670 N Inpp4b n/a
2 TRCN0000080647 CCTAAGGAATTGATTTCCCTT pLKO.1 1488 CDS 100% 2.640 2.112 N Inpp4b n/a
3 TRCN0000052722 CCTCCTGATTATATTTCACAT pLKO.1 3069 CDS 100% 4.950 3.465 N INPP4B n/a
4 TRCN0000080645 CCAAAGAAACAGGGTCCTCTT pLKO.1 1651 CDS 100% 4.050 2.835 N Inpp4b n/a
5 TRCN0000381328 AGAGCCTGAACTGCATTATTG pLKO_005 2284 CDS 100% 13.200 10.560 N INPP4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312729.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.