Transcript: Mouse XM_017312847.2

PREDICTED: Mus musculus UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6 (Galntl6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Galntl6 (270049)
Length:
7134
CDS:
354..2441

Additional Resources:

NCBI RefSeq record:
XM_017312847.2
NBCI Gene record:
Galntl6 (270049)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312847.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093855 GCGGACCATACACAGTATAAT pLKO.1 1106 CDS 100% 15.000 21.000 N Galntl6 n/a
2 TRCN0000265471 GCGGACCATACACAGTATAAT pLKO_005 1106 CDS 100% 15.000 21.000 N GALNTL6 n/a
3 TRCN0000454138 CCCTTTGAGTCTCCGGTTATG pLKO_005 1551 CDS 100% 10.800 8.640 N Galntl6 n/a
4 TRCN0000093856 GCAGAAATCATTCTAGTCGAT pLKO.1 1152 CDS 100% 2.640 2.112 N Galntl6 n/a
5 TRCN0000093857 ACCAGCATCATTATCCCATTT pLKO.1 1059 CDS 100% 10.800 7.560 N Galntl6 n/a
6 TRCN0000093858 CCATGCCAACTGTAAGCACAA pLKO.1 1013 CDS 100% 4.050 2.430 N Galntl6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312847.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.