Transcript: Mouse XM_017312877.1

PREDICTED: Mus musculus unc-13 homolog A (C. elegans) (Unc13a), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Unc13a (382018)
Length:
7084
CDS:
125..5278

Additional Resources:

NCBI RefSeq record:
XM_017312877.1
NBCI Gene record:
Unc13a (382018)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312877.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028276 CCCGTGTGAAACAAAGGTTTA pLKO.1 2418 CDS 100% 10.800 15.120 N Unc13a n/a
2 TRCN0000379932 AGGTGATGTGGAGCCTATTTG pLKO_005 3420 CDS 100% 13.200 10.560 N Unc13a n/a
3 TRCN0000381962 CATCCTCCTGGACGCTCATTT pLKO_005 484 CDS 100% 13.200 9.240 N Unc13a n/a
4 TRCN0000381244 ATCACCCTCATCGTGTCTATC pLKO_005 3320 CDS 100% 10.800 7.560 N Unc13a n/a
5 TRCN0000381939 CCGGATCAAGGTTCGTGTTTG pLKO_005 2374 CDS 100% 10.800 7.560 N Unc13a n/a
6 TRCN0000028224 GCCTGAGATCTTCGAGCTTAT pLKO.1 2080 CDS 100% 10.800 7.560 N Unc13a n/a
7 TRCN0000028223 CCAAGAGAAGTTCAACACATA pLKO.1 172 CDS 100% 4.950 3.465 N Unc13a n/a
8 TRCN0000028239 GCTGCCTCTAATTTCGGGAAA pLKO.1 2936 CDS 100% 4.050 2.835 N Unc13a n/a
9 TRCN0000028291 CCTAGCATCAAGAACCTGGAT pLKO.1 3284 CDS 100% 2.640 1.848 N Unc13a n/a
10 TRCN0000246218 GCGACAAGAAACGCAAGTTTG pLKO_005 4902 CDS 100% 10.800 15.120 N UNC13A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312877.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.