Transcript: Mouse XM_017313062.1

PREDICTED: Mus musculus leucyl-tRNA synthetase, mitochondrial (Lars2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lars2 (102436)
Length:
4108
CDS:
1156..3120

Additional Resources:

NCBI RefSeq record:
XM_017313062.1
NBCI Gene record:
Lars2 (102436)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076061 CCAGAGTGGTACGGAATCAAA pLKO.1 1186 CDS 100% 5.625 7.875 N Lars2 n/a
2 TRCN0000076060 GCCTCATTAAGGGACAGACAT pLKO.1 2198 CDS 100% 4.950 6.930 N Lars2 n/a
3 TRCN0000076059 CGTGACAAGTAACAAGCTGAA pLKO.1 1722 CDS 100% 4.050 3.240 N Lars2 n/a
4 TRCN0000437096 GCAAGCTCTGTGACCATTATG pLKO_005 2831 CDS 100% 13.200 9.240 N Lars2 n/a
5 TRCN0000433343 GTCTGAAGAAGGAGGATATAG pLKO_005 2240 CDS 100% 13.200 9.240 N Lars2 n/a
6 TRCN0000438579 ATGAGAGGCATGCAGGTTATC pLKO_005 556 5UTR 100% 10.800 7.560 N Lars2 n/a
7 TRCN0000076062 CCTCATGTAACCTCAGAACTT pLKO.1 2785 CDS 100% 4.950 3.465 N Lars2 n/a
8 TRCN0000076058 CCTATCATTGTGAAGCAGAAT pLKO.1 3473 3UTR 100% 4.950 2.475 Y Lars2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.