Transcript: Mouse XM_017313108.1

PREDICTED: Mus musculus RAS p21 protein activator 2 (Rasa2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rasa2 (114713)
Length:
4898
CDS:
133..1815

Additional Resources:

NCBI RefSeq record:
XM_017313108.1
NBCI Gene record:
Rasa2 (114713)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313108.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034349 GCGCGATTGTTTCTGCACTAT pLKO.1 306 CDS 100% 4.950 6.930 N Rasa2 n/a
2 TRCN0000301607 GCGCGATTGTTTCTGCACTAT pLKO_005 306 CDS 100% 4.950 6.930 N Rasa2 n/a
3 TRCN0000304370 TCCAGATGCCAACGCAATATT pLKO_005 1296 CDS 100% 15.000 10.500 N Rasa2 n/a
4 TRCN0000034350 GCAGTCATAGTGGTAAAGAAA pLKO.1 515 CDS 100% 5.625 3.938 N Rasa2 n/a
5 TRCN0000301606 GCAGTCATAGTGGTAAAGAAA pLKO_005 515 CDS 100% 5.625 3.938 N Rasa2 n/a
6 TRCN0000034351 CCTGTGAAATAGATCCTGTTA pLKO.1 1433 CDS 100% 4.950 3.465 N Rasa2 n/a
7 TRCN0000301698 CCTGTGAAATAGATCCTGTTA pLKO_005 1433 CDS 100% 4.950 3.465 N Rasa2 n/a
8 TRCN0000034353 CGGCAGGATCTATGAAGCAAA pLKO.1 252 CDS 100% 4.950 3.465 N Rasa2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313108.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.