Transcript: Mouse XM_017313221.1

PREDICTED: Mus musculus sodium channel, voltage-gated, type X, alpha (Scn10a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Scn10a (20264)
Length:
5531
CDS:
361..4674

Additional Resources:

NCBI RefSeq record:
XM_017313221.1
NBCI Gene record:
Scn10a (20264)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313221.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439546 GAACAGAGCCAGGCAACAATT pLKO_005 1561 CDS 100% 13.200 9.240 N Scn10a n/a
2 TRCN0000068891 CCAGAAGAAGTGGAACATCTT pLKO.1 2532 CDS 100% 4.950 3.465 N Scn10a n/a
3 TRCN0000068892 CCATATTTATCACTGTCACTA pLKO.1 758 CDS 100% 4.950 3.465 N Scn10a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313221.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.