Transcript: Mouse XM_017313871.1

PREDICTED: Mus musculus transcription factor 3 (Tcf3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tcf3 (21423)
Length:
3247
CDS:
698..2656

Additional Resources:

NCBI RefSeq record:
XM_017313871.1
NBCI Gene record:
Tcf3 (21423)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313871.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233412 TTTGACCCTAGCCGGACATAC pLKO_005 905 CDS 100% 10.800 15.120 N Tcf3 n/a
2 TRCN0000086614 CCAGCAATAATTTCTCACCTA pLKO.1 1725 CDS 100% 2.640 2.112 N Tcf3 n/a
3 TRCN0000086617 CCGGATCACTCCAGCAATAAT pLKO.1 1715 CDS 100% 15.000 10.500 N Tcf3 n/a
4 TRCN0000233414 CCCGGATCACTCCAGCAATAA pLKO_005 1714 CDS 100% 13.200 9.240 N Tcf3 n/a
5 TRCN0000233413 TGCATGGATCTGAGGTTAATG pLKO_005 1521 CDS 100% 13.200 9.240 N Tcf3 n/a
6 TRCN0000233416 GCACATCGTGCCTAAGCATTT pLKO_005 2993 3UTR 100% 10.800 7.560 N Tcf3 n/a
7 TRCN0000086615 GCGACATCAATGAGGCCTTTA pLKO.1 2379 CDS 100% 10.800 7.560 N Tcf3 n/a
8 TRCN0000086616 CCTGGACTTCAGCATGATGTT pLKO.1 757 CDS 100% 4.950 3.465 N Tcf3 n/a
9 TRCN0000086613 CCTTAACTATGTAAGACGGAA pLKO.1 2914 3UTR 100% 2.640 1.848 N Tcf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313871.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.