Transcript: Mouse XM_017313906.1

PREDICTED: Mus musculus methyltransferase like 25 (Mettl25), transcript variant X14, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mettl25 (216292)
Length:
2121
CDS:
585..1952

Additional Resources:

NCBI RefSeq record:
XM_017313906.1
NBCI Gene record:
Mettl25 (216292)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313906.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250286 CCAGTACTCTGCGGATATTTA pLKO_005 1303 CDS 100% 15.000 10.500 N Mettl25 n/a
2 TRCN0000250288 TGGACTACTATGAGAATTATA pLKO_005 1723 CDS 100% 15.000 10.500 N Mettl25 n/a
3 TRCN0000258034 CACCGATGGTTTGCCTGATTT pLKO_005 953 CDS 100% 13.200 9.240 N Mettl25 n/a
4 TRCN0000250287 GGCAAGGGACTCAAGCATATA pLKO_005 1175 CDS 100% 13.200 9.240 N Mettl25 n/a
5 TRCN0000216336 GATTCTTCTTGATCGACTTTG pLKO.1 1814 CDS 100% 10.800 7.560 N Mettl25 n/a
6 TRCN0000250289 TTCTGGTAAAGGCTATCTAAG pLKO_005 680 CDS 100% 10.800 7.560 N Mettl25 n/a
7 TRCN0000189679 GCTCTGAAGAAGCAGTGTGAT pLKO.1 1923 CDS 100% 4.950 3.465 N Mettl25 n/a
8 TRCN0000192422 CAGAGAGTTGAAAGTGCCAAA pLKO.1 863 CDS 100% 4.050 2.835 N Mettl25 n/a
9 TRCN0000168716 GCTTGGATTAGATGAGTCCAA pLKO.1 1682 CDS 100% 0.264 0.185 N METTL25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313906.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.