Transcript: Mouse XM_017313936.1

PREDICTED: Mus musculus zinc finger protein 938 (Zfp938), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp938 (237411)
Length:
2214
CDS:
110..1735

Additional Resources:

NCBI RefSeq record:
XM_017313936.1
NBCI Gene record:
Zfp938 (237411)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313936.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235191 ACTGGAGAGAAACCATATAAA pLKO_005 1199 CDS 100% 15.000 7.500 Y Gm4767 n/a
2 TRCN0000235210 ACTGGAGAGAAACCATATAAA pLKO_005 1199 CDS 100% 15.000 7.500 Y EG666477 n/a
3 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 1283 CDS 100% 15.000 7.500 Y ZNF443 n/a
4 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 1283 CDS 100% 15.000 7.500 Y Zfp97 n/a
5 TRCN0000242409 GAATGTAACCAATGTGGTAAA pLKO_005 1469 CDS 100% 10.800 5.400 Y Gm14418 n/a
6 TRCN0000175115 GAATGTAATCAGTGTGGTAAA pLKO.1 881 CDS 100% 10.800 5.400 Y Zfp935 n/a
7 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 1452 CDS 100% 5.625 2.813 Y ZNF345 n/a
8 TRCN0000015520 CTGGAGAGAAGCCTTATGAAT pLKO.1 1368 CDS 100% 5.625 2.813 Y ZNF625 n/a
9 TRCN0000193091 CAAAGGCATGAAAGGATTCAT pLKO.1 1346 CDS 100% 0.563 0.281 Y Zfp935 n/a
10 TRCN0000235192 GCCTTTGCATATCGCAGTAAT pLKO_005 1406 CDS 100% 13.200 6.600 Y Gm4767 n/a
11 TRCN0000235211 GCCTTTGCATATCGCAGTAAT pLKO_005 1406 CDS 100% 13.200 6.600 Y EG666477 n/a
12 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1117 CDS 100% 13.200 6.600 Y Zfp977 n/a
13 TRCN0000193310 CCTATGAATGTAATCAGTGTA pLKO.1 876 CDS 100% 4.950 2.475 Y Zfp932 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313936.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.