Transcript: Mouse XM_017314109.1

PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 2 (Cnot2), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cnot2 (72068)
Length:
3468
CDS:
838..2433

Additional Resources:

NCBI RefSeq record:
XM_017314109.1
NBCI Gene record:
Cnot2 (72068)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314109.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375964 TGACGACAGCAAATCTAATTT pLKO_005 1695 CDS 100% 15.000 21.000 N Cnot2 n/a
2 TRCN0000238810 TTACCTGGTTCCAGCTATAAA pLKO_005 1657 CDS 100% 15.000 21.000 N Cnot2 n/a
3 TRCN0000233435 GTGAAGATCCTTCTCGTATTT pLKO_005 2854 3UTR 100% 13.200 18.480 N Cnot2 n/a
4 TRCN0000234899 GTGAAGATCCTTCTCGTATTT pLKO_005 2854 3UTR 100% 13.200 18.480 N CNOT2 n/a
5 TRCN0000233433 AGCGTTAGCTGACCGGAATAG pLKO_005 1503 CDS 100% 10.800 15.120 N Cnot2 n/a
6 TRCN0000103582 CGAGTTACTAACATTCCTCAA pLKO.1 1834 CDS 100% 4.050 5.670 N Cnot2 n/a
7 TRCN0000103584 CGGCAACCCAACTCCATTAAT pLKO.1 1536 CDS 100% 15.000 12.000 N Cnot2 n/a
8 TRCN0000233432 ACTCCTTATCAAGTAACATTT pLKO_005 1427 CDS 100% 13.200 10.560 N Cnot2 n/a
9 TRCN0000234895 ACTCCTTATCAAGTAACATTT pLKO_005 1427 CDS 100% 13.200 10.560 N CNOT2 n/a
10 TRCN0000233434 CTCAATACACAACGAAGATTT pLKO_005 1629 CDS 100% 13.200 10.560 N Cnot2 n/a
11 TRCN0000103581 GCAATCAAACTTGGCCGATAT pLKO.1 2107 CDS 100% 10.800 8.640 N Cnot2 n/a
12 TRCN0000103580 GCATTGTTCATTGTAGCACTA pLKO.1 2797 3UTR 100% 4.050 3.240 N Cnot2 n/a
13 TRCN0000375884 CCATGTTCCATCAGAATATTT pLKO_005 2055 CDS 100% 15.000 10.500 N Cnot2 n/a
14 TRCN0000375965 GGTCCTGCCTTACCAATTATG pLKO_005 2575 3UTR 100% 13.200 9.240 N Cnot2 n/a
15 TRCN0000015132 CAGGTGACAAACAGCATGTTT pLKO.1 856 CDS 100% 5.625 3.938 N CNOT2 n/a
16 TRCN0000015128 CCTCAGTTAAATCGCAGCTTA pLKO.1 1090 CDS 100% 4.950 3.465 N CNOT2 n/a
17 TRCN0000015131 CCGTGATTGGAGATACCACAA pLKO.1 2208 CDS 100% 4.050 2.835 N CNOT2 n/a
18 TRCN0000103583 CCTTTCAGATTTCCCAGCGTT pLKO.1 1488 CDS 100% 2.640 1.848 N Cnot2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314109.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.