Transcript: Mouse XM_017314183.1

PREDICTED: Mus musculus predicted gene 4924 (Gm4924), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm4924 (237412)
Length:
3472
CDS:
163..3099

Additional Resources:

NCBI RefSeq record:
XM_017314183.1
NBCI Gene record:
Gm4924 (237412)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314183.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243549 CCCAGAAGAGTCTCTACAAAG pLKO_005 233 CDS 100% 10.800 5.400 Y Gm9222 n/a
2 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 2255 CDS 100% 5.625 2.813 Y ZNF345 n/a
3 TRCN0000093238 GAGTCTCTACAAAGATGTGAT pLKO.1 240 CDS 100% 4.950 2.475 Y Gm4983 n/a
4 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1248 CDS 100% 13.200 6.600 Y Zfp977 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314183.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.