Transcript: Mouse XM_017314672.2

PREDICTED: Mus musculus SRC kinase signaling inhibitor 1 (Srcin1), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Srcin1 (56013)
Length:
7748
CDS:
165..4574

Additional Resources:

NCBI RefSeq record:
XM_017314672.2
NBCI Gene record:
Srcin1 (56013)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314672.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177625 CCAAGACCGAAGTATCATTAA pLKO.1 1178 CDS 100% 13.200 18.480 N Srcin1 n/a
2 TRCN0000216728 GACCTCACAATGATGCAATTA pLKO.1 6276 3UTR 100% 13.200 18.480 N Srcin1 n/a
3 TRCN0000163534 GCAGGCCACTAAACCATCTAA pLKO.1 4436 CDS 100% 5.625 7.875 N SRCIN1 n/a
4 TRCN0000182328 GCTGAAACCGACTTCAGCAAA pLKO.1 3006 CDS 100% 0.495 0.693 N Srcin1 n/a
5 TRCN0000197547 CCGAAGTATCATTAAGATCTA pLKO.1 1184 CDS 100% 4.950 3.960 N Srcin1 n/a
6 TRCN0000197730 GAAAGACTCAGTCTTCATCAA pLKO.1 3554 CDS 100% 4.950 3.465 N Srcin1 n/a
7 TRCN0000200126 CCATCCCTGTATTGACTTCCT pLKO.1 4522 CDS 100% 2.640 1.848 N Srcin1 n/a
8 TRCN0000178553 CCCAAGAACACTTGGAACAAA pLKO.1 4951 3UTR 100% 0.563 0.394 N Srcin1 n/a
9 TRCN0000182746 CAGCAAGAGAAACACGGACAA pLKO.1 3149 CDS 100% 4.050 2.430 N Srcin1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314672.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.