Transcript: Mouse XM_017314761.1

PREDICTED: Mus musculus sperm associated antigen 9 (Spag9), transcript variant X13, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spag9 (70834)
Length:
6907
CDS:
165..3659

Additional Resources:

NCBI RefSeq record:
XM_017314761.1
NBCI Gene record:
Spag9 (70834)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314761.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217384 GATAGGAAGTGCAGGTTAAAT pLKO.1 6083 3UTR 100% 15.000 21.000 N Spag9 n/a
2 TRCN0000215316 CACTAATAACAGACGGATTAT pLKO.1 4097 3UTR 100% 13.200 18.480 N Spag9 n/a
3 TRCN0000197843 GTCCTATATCATTAGGGATTT pLKO.1 268 CDS 100% 10.800 15.120 N Spag9 n/a
4 TRCN0000177286 GCTCTTCAAGTAATGCAACAA pLKO.1 1336 CDS 100% 4.950 6.930 N Spag9 n/a
5 TRCN0000177089 CCAGTGTTTCAGTCAAGTAAT pLKO.1 2451 CDS 100% 13.200 10.560 N Spag9 n/a
6 TRCN0000197596 CTCTTCAAGTAATGCAACAAA pLKO.1 1337 CDS 100% 5.625 3.938 N Spag9 n/a
7 TRCN0000177582 CCTGAATTGGATATGGACAAA pLKO.1 672 CDS 100% 4.950 3.465 N Spag9 n/a
8 TRCN0000176696 CCACATAATAATGTGAGCATT pLKO.1 3759 3UTR 100% 0.495 0.347 N Spag9 n/a
9 TRCN0000148340 CCAGGGACATTTATACCCTAT pLKO.1 3300 CDS 100% 4.050 2.835 N SPAG9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314761.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.