Transcript: Mouse XM_017314769.1

PREDICTED: Mus musculus RIKEN cDNA 0610010F05 gene (0610010F05Rik), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
0610010F05Rik (71675)
Length:
4764
CDS:
411..2534

Additional Resources:

NCBI RefSeq record:
XM_017314769.1
NBCI Gene record:
0610010F05Rik (71675)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314769.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217874 GGTACGAAGAGAGGTCTTAAA pLKO.1 3369 3UTR 100% 13.200 18.480 N 0610010F05Rik n/a
2 TRCN0000268116 GGTACGAAGAGAGGTCTTAAA pLKO_005 3369 3UTR 100% 13.200 18.480 N 0610010F05Rik n/a
3 TRCN0000283618 GATTGTGAGATTCCCGCTTTA pLKO_005 1059 CDS 100% 10.800 15.120 N 0610010F05Rik n/a
4 TRCN0000216149 CAACCAGTATAACCCTTTAAT pLKO.1 611 CDS 100% 15.000 12.000 N 0610010F05Rik n/a
5 TRCN0000178818 CGGAACACTAAGGAGAGTAAA pLKO.1 1038 CDS 100% 13.200 10.560 N 0610010F05Rik n/a
6 TRCN0000215632 GCTAGGTGTTCTATTAGTTAT pLKO.1 2667 3UTR 100% 13.200 10.560 N 0610010F05Rik n/a
7 TRCN0000183109 CAGAAGGTTCTTCGATTTGAT pLKO.1 1737 CDS 100% 5.625 4.500 N 0610010F05Rik n/a
8 TRCN0000179901 CCAAACATGGTGATCCATGTA pLKO.1 843 CDS 100% 0.495 0.396 N 0610010F05Rik n/a
9 TRCN0000268119 ACCTGTTGACAACCAGTATAA pLKO_005 602 CDS 100% 13.200 9.240 N 0610010F05Rik n/a
10 TRCN0000268118 TGAAATTACAGGGCATCTAAT pLKO_005 2333 CDS 100% 13.200 9.240 N 0610010F05Rik n/a
11 TRCN0000268117 TGATTCTTTATCCATTGATTG pLKO_005 475 CDS 100% 10.800 7.560 N 0610010F05Rik n/a
12 TRCN0000167296 CCATGCAACATGAACTGTATT pLKO.1 1194 CDS 100% 13.200 9.240 N KIAA1841 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314769.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.