Transcript: Mouse XM_017314779.1

PREDICTED: Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 42 (Ddx42), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ddx42 (72047)
Length:
3320
CDS:
349..2346

Additional Resources:

NCBI RefSeq record:
XM_017314779.1
NBCI Gene record:
Ddx42 (72047)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314779.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104032 GCCCATGTTGATTCATATAAT pLKO.1 483 CDS 100% 15.000 21.000 N Ddx42 n/a
2 TRCN0000309017 GCCCATGTTGATTCATATAAT pLKO_005 483 CDS 100% 15.000 21.000 N Ddx42 n/a
3 TRCN0000104030 GCGTCGTCAGTCGTCTTTAAT pLKO.1 2364 3UTR 100% 15.000 12.000 N Ddx42 n/a
4 TRCN0000309020 GCGTCGTCAGTCGTCTTTAAT pLKO_005 2364 3UTR 100% 15.000 12.000 N Ddx42 n/a
5 TRCN0000104033 GCGAAAGAAACAAGGTTATTT pLKO.1 1160 CDS 100% 15.000 10.500 N Ddx42 n/a
6 TRCN0000309018 GCGAAAGAAACAAGGTTATTT pLKO_005 1160 CDS 100% 15.000 10.500 N Ddx42 n/a
7 TRCN0000104034 CCAGTGACCTACCCTTCTATT pLKO.1 1885 CDS 100% 13.200 9.240 N Ddx42 n/a
8 TRCN0000308949 CCAGTGACCTACCCTTCTATT pLKO_005 1885 CDS 100% 13.200 9.240 N Ddx42 n/a
9 TRCN0000104031 CCTTCCATTAAGACAGTCATT pLKO.1 1249 CDS 100% 4.950 3.465 N Ddx42 n/a
10 TRCN0000331906 CCTTCCATTAAGACAGTCATT pLKO_005 1249 CDS 100% 4.950 3.465 N Ddx42 n/a
11 TRCN0000051029 GCAATGCAGAATGCCTGGTTT pLKO.1 1450 CDS 100% 4.950 3.465 N DDX42 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314779.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.