Transcript: Mouse XM_017314819.1

PREDICTED: Mus musculus centrosomal protein 112 (Cep112), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cep112 (76380)
Length:
3480
CDS:
46..3060

Additional Resources:

NCBI RefSeq record:
XM_017314819.1
NBCI Gene record:
Cep112 (76380)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314819.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184619 GAACTAGAAACCCGCTCTCAT pLKO.1 2812 CDS 100% 4.950 6.930 N Cep112 n/a
2 TRCN0000292778 GAACTAGAAACCCGCTCTCAT pLKO_005 2812 CDS 100% 4.950 6.930 N Cep112 n/a
3 TRCN0000180757 GCGTCTCTAAGACAAGAACTT pLKO.1 2941 CDS 100% 4.950 3.960 N Cep112 n/a
4 TRCN0000292704 GCGTCTCTAAGACAAGAACTT pLKO_005 2941 CDS 100% 4.950 3.960 N Cep112 n/a
5 TRCN0000179475 GCAGAACTTCAGACAACCATT pLKO.1 2656 CDS 100% 4.950 3.465 N CEP112 n/a
6 TRCN0000180489 GCAGGAGCAGATAATGTACAT pLKO.1 2880 CDS 100% 4.950 3.465 N Cep112 n/a
7 TRCN0000292713 GCAGGAGCAGATAATGTACAT pLKO_005 2880 CDS 100% 4.950 3.465 N Cep112 n/a
8 TRCN0000184426 GAAGAACTGACCACCTACCAA pLKO.1 3028 CDS 100% 3.000 2.100 N Cep112 n/a
9 TRCN0000292779 GAAGAACTGACCACCTACCAA pLKO_005 3028 CDS 100% 3.000 2.100 N Cep112 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314819.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13386 pDONR223 100% 78% 78.7% None (many diffs) n/a
2 ccsbBroad304_13386 pLX_304 0% 78% 78.7% V5 (many diffs) n/a
Download CSV